Domain: openwetware.org

Overview
Ads (0)
PPC Keywords (0)
Organic Keywords (3,598)
Competitors (1,121)
Sub-Domains
openwetware.org  
Statistics
Daily Ad Budget: N/A active PPC Ad Copies: 0  
Total Clicks/Day: N/A PPC Keywords: 0
Average Ad Position: N/A PPC Competitors: 0  
Average Cost/Click: N/A  
PPC Overview
No Results Found
Organic Overview
Keywords (3,598) Position
de pc 2
pan who 4
k1 k 1 2
k k1 2
a addition 5
be 109 4
de buffer 6
unix for in 14
n hc 1
k1 k1 9
View More »
Competitors (1,145) Keywords
en.wikipedia.org 28,718,623
amazon.com 22,358,187
protocol-online.org 30,308
ncbi.nlm.nih.gov 1,931,895
youtube.com 30,834,319
biocompare.com 58,349
promega.com 10,939
answers.com 3,119,011
pubmedcentral.nih.gov 1,319,359
imdb.com 6,038,962
View More »
Organic Listing Variations
1.
Knight:Orders - OpenWetWare
EZ-Tn5 transposase; 1 case 10 Axygen MCT-060-C-S microtubes; 1 case 10 Axygen MCT-175-C-S microtubes; 3x case Nalgene Cryoware Cryo Vials, Cat # 5000-0020 ...
2.
Harvard:Biophysics 101/Notebook:ZS/2007-5-3 - OpenWetWare
May 3, 2007 ... This code is able to queue a website, http://icd9cm.chrisendres.com # *which has the database of diseases - it returns the best hits # *in ...
3.
Harvard:Biophysics 101/Notebook:ZS/2007-4-18 - OpenWetWare
This code is able to queue a website, http://icd9cm.chrisendres.com # *which has the database of diseases - it returns the best hits # *in dirty HTML, ...
4.
PORTABLE ELECTRICAL TESTING
File Format: Microsoft Word - View as HTML If it’s not marked, refer to an E.C.P.; Establish the Class of the device (Class I / II); If appropriate, perform the earth continuity test. ...
5.
Eccles:QPCR reference genes - OpenWetWare
Apr 10, 2008 ... DGG ID: 2769; DGG name: Hs_ACTB_F; Current [stock]: 64.4 uM ... RTPrimerDB ID: 8; Alias Symbol(s): HMG20; Organism: Homo sapiens (Hs, Human) .... Forward Primer TCAGTCAACGGGGGACATAAA 21 60.8 324-344 Exon 4 ...
6.
Image:PACYC-map.pdf - OpenWetWare
Jun 18, 2008 ... PACYC-map.pdf‎ (file size: 175 KB, MIME type: application/pdf) ... Retrieved from "http://openwetware.org/wiki/Image:PACYC-map.pdf" ...
7.
Microsoft PowerPoint - Nanobiosensors08.ppt
File Format: PDF/Adobe Acrobat - View as HTML [4] P. M. Kasili and T. Vo-Dinh, "Optical nanobiosensor for monitoring an apoptotic ... [6] T. Vo-Dinh, "Nanobiosensors: Probing the sanctuary of individual ...
8.
Nanodrop - OpenWetWare
Sep 21, 2007 ... Open the Nanodrop program and the appropriate module (e.g., DNA). ... unresponsive and the machine was stuck in a measurement state. ...
9.
Talk:Quantitating nucleic acids - OpenWetWare
Feb 5, 2007 ... The words "precision" and "measure" only occur in the "quantitate" definition, and not the "quantify" definition at dictionary.com, ...
10.
Affymetrix Two Cycle Eukaryotic Gene Expression Sample Processing ...
Oct 12, 2006 ... 1 Affymetrix Two Cycle Eukaryotic Gene Expression Sample Processing; 2 RNA sample quality; 3 Workflow; 4 Materials; 5 cDNA Synthesis ...
 
View More »
ascSort Ascending
descSort Descending
eqEquals...
!eqDoes Not Equal...
gtGreater Than...
gteqGreater Than or Equal To...
ltLess Than...
lteqLess Than or Equal To...
      And   Or
                
Sometimes you don’t know exactly what you are looking for in a Research data. That’s when our searching options may come handy.
The Domain Search
This search allows you to enter the domain name of the site you want to analyze. For example, you may enter “amazon.com” in the KeywordSpy search bar.

The Keyword Search
This will let you enter terms and key phrases in the search bar such as “send flowers”, “cover letters”, “keyword software,” and even a single broad term like “chocolate”.

The Ad Copy Search
This allows you to enter any texts or content included in an ad copy, whether the ones in ad copy headline or the ones in description lines. For example: “sunglasses”.
The Destination URL Search
This search allows you to enter the destination URL of the site that you want to analyze.

The destination URL is the address where a searcher is taken when an advertisement copy in search engines is clicked. Please take note that the destination URL differs from the display URL which appears at the bottom of advertisement copies.

Please be reminded to always include http:// at the beginning of your Destination URL search. For example: “http://www.proflowers.com”.

In addition, if you want to find all the ads that KeywordSpy indexed for a specific affiliate network e.g. Hydra Network. You should search in Destination URL the string lynxtrack.com.
Loading
  Loading...