1.
- Life Science Learning Center
Family Secrets was developed as a collaboration between the University of Rochester 's Life Sciences Learning Center and the New York State ...
2.
Jenga Ecology:
File Format: Microsoft Word - View as HTML The rules below were taken from the Jenga box and modified to fit Jenga Ecology. Object: To obtain the appropriate blocks to fill in your game board with a ...
3.
- Life Science Learning Center
Would you like to do PCR with your students? If you have a PCR machine and you ... Are you interested in teaching your students about alternative energy? ...
4.
- Life Science Learning Center
If a picture is worth a thousand words, how many words and ideas can you express in a movie? Use PowerPoint to its fullest potential by learning to create ...
5.
aaatacccaattcgacgtgacccgatcgatcgccc attttccaggttgagatt ...
File Format: Shockwave Flash The micropipette uses disposable tips to pick liquid up. That way, you can use a new tip for every liquid, preventing contamination between samples. ...
6.
- Life Science Learning Center
If you are a K-12 teacher looking for an animation, email us at LSLC_MEDIA@urmc.rochester.edu. We can help you find animations on the web and have a limited ...
7.
Developers drain your habitat, lose one offspring card
File Format: Microsoft Word - View as HTML Two young adult male hippos fight over territory. One offspring is accidentally trampled. Player across from you loses one offspring card. ...
8.
Developers drain your habitat, lose one offspring card
File Format: Microsoft Word - View as HTML Two young adult male hippos fight over territory. One offspring is accidentally trampled. Player across from you loses one offspring card. ...
9.
Finding a Cure: Which HIV vaccine would you choose?
File Format: Microsoft Powerpoint - View as HTML Finding a Cure: Which HIV vaccine would you choose? Ramil Sapinoro. Life Sciences Learning Center. University of Rochester Medical Center. AIDSVax Inc. ...
10.
HIV Vaccine Research
File Format: Microsoft Powerpoint - View as HTML The success with vaccination against other viruses is a window of optimism, and the over 10 HIV vaccine trials currently ongoing include the use of ...
