1.
Gap Closure using the Amersham Phi29 Sequence Finishing Kits for ...
Gap Closure using the Amersham Phi29 Sequence Finishing Kits for DNA Amplification Prior to Sequencing. version dated 05-26-05 ...
2.
IV. Methods for DNA sequencing
The following is a rapid and efficient method for sequencing cloned cDNAs based on PCR amplification (14), random shotgun cloning (1,3,15), and automated ...
3.
Cleared Lysate Method - Double Acetate BAC Isolation from 200 ml ...
Mar 14, 2002 ... The following ribonuclease treatment step reduces the amount of RNA present in the final BAC preparation. After thawing, centrifuge at 10K ...
4.
Oligonucleotide universal primers used for DNA sequencing
BamH1.SmaI.EcoR GGCCAGTGCCAAGCTTGGCTGCAGGTCGACGGATCCCCGGGAATTCGTAATCATG M13mp9 .......EcoR1. ... Commonly used restriction enzymes and assay buffers. Common Assay Incub. Recognition. Enzyme isoschizomers buffer temp. site Cloning sites ...
5.
Oligonucleotide universal primers used for DNA sequencing
BamH1.SmaI.EcoR GGCCAGTGCCAAGCTTGGCTGCAGGTCGACGGATCCCCGGGAATTCGTAATCATG M13mp9 .......EcoR1.SmaI. ... Enzyme isoschizomers buffer temp. site Cloning sites ...
6.
Neisseria gonorrhoeae Genome Sequencing - Strain FA 1090
Other web sites that may be of interest: Neisseria meningitidis Genome Sequencing at The Sanger Center; Other Microbial Genome Projects at the Sanger Center ...
7.
Fungal Genomic Cosmid and cDNA Sequencing
Fungal Genomic (Cosmid Cloned) DNA Sequencing ... Texas raramayo@bio.tamu.edu and over 6000 cDNA clones from an evening Neurospora crassa cDNA library and ...
8.
Streptococcus mutans Genome Sequencing
The sequence of the 2030936 bp Streptococcus mutans strain UA159 Genome is ... Not Yet Working - Search the Streptococcus mutans Genome sequence data at the ...
9.
II. Random subclone generation
A nebulizer containing 2 ml of a buffered DNA solution (approximately 50 ug) ... To prepare for fragment end-repair, the nebulized DNA typically is divided ...
10.
The University of Oklahoma's Advanced Center for Genome Technology
Feb 11, 2009 ... As part of the world wide human genome project this site contains methods, protocols and data for our human, mouse, bacterial, fiddler crab, ... Show map of 660 Parrington Oval, Norman, OK 73019
