Domain: cardiff.ac.uk

Overview
Ads (1)
PPC Keywords (1)
Organic Keywords (9,551)
Competitors (1,336)
Sub-Domains
cardiff.ac.uk  
Statistics
Daily Ad Budget: N/A active PPC Ad Copies: 1  
Total Clicks/Day: N/A PPC Keywords: 1
Average Ad Position: N/A PPC Competitors: 208  
Average Cost/Click: N/A  
Ad Variations
International Summer School UK
A unique research experience in one of
the UK’s most vibrant capital cities.
cardiff.ac.uk
View More »
Organic Overview
Keywords (9,551) Position
the it shop 16
l es 14
why go to 12
be international 14
b e international 14
why study 9
arabic for 13
are language 9
information on what 16
cp el 3
View More »
Competitors (1,153) Keywords
en.wikipedia.org 28,718,623
amazon.com 22,358,187
books.google.com 13,486,892
youtube.com 30,834,319
britannica.com 1,754,349
findarticles.com 8,811,884
theoi.com 34,078
fromoldbooks.org 12,707
bbc.co.uk 1,829,808
hhmi.org 26,079
View More »
Organic Listing Variations
1.
School of Earth & Ocean Sciences
RAE 2008 Results for the School of Earth and Ocean Sciences ... A lecturer series organised by the Schools of Biosciences and Earth & Ocean Sciences ...
2.
Images Index
Jan 21, 2002 ... IMAGES: INDEX OF ILLUSTRATIONS. GUSTAVE DOR AND BLANCHARD JERROLD, London: A Pilgrimage (1872). Father Thames, London Bridge, 1872 ...
3.
National Insurance Numbers
File Format: PDF/Adobe Acrobat - View as HTML A National Insurance number is unique to you throughout your ... If you change your name then you should inform the Inland Revenue. This is ...
4.
The following titles are some of the available material for the ...
File Format: PDF/Adobe Acrobat - View as HTML University of Cambridge ESOL Examinations. Contains one complete Listening test, Academic Reading test and. General Training Reading test. ...
5.
Career Planning Inter.eps
File Format: PDF/Adobe Acrobat - View as HTML www.brunel.ac.uk/pcc/students/inter.shtml - Brunel University have ..... Register with Unistaff Jobshop in the Students’ Union for part-time work as early ...
6.
pACYC177 DNA sequence
pACYC177. - Reference:. Chang, A. C. Y. and Cohen, S. N. 1978. J. Bacteriol. 134: 1141-1156. gttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaa ...
7.
pACYC184 DNA sequence
pACYC184. - Reference:. Chang, A. C. Y. and Cohen, S. N. 1978. J. Bacteriol. 134: 1141-1156. GAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCG ...
8.
The following titles are some of the available material for the ...
File Format: PDF/Adobe Acrobat - View as HTML For full details please visit www.cambridge.org/elt. Action Plan for IELTS Self-study Student’s Book. Vanessa Jakeman and Clare McDowell ...
9.
ARCHIVE TO GO
File Format: PDF/Adobe Acrobat - View as HTML Archive To Go does not export GroupWise Find Results Folders. Please ensure that you fully read the contents of this User Guide before proceeding. ...
10.
Indian journalist returns to career launch pad in Cardiff
Indian journalist returns to career launch pad in Cardiff. 1 May 2007. Piyush Roy with Professor Terry Threadgold. A leading Indian journalist has returned ...
 
View More »
ascSort Ascending
descSort Descending
eqEquals...
!eqDoes Not Equal...
gtGreater Than...
gteqGreater Than or Equal To...
ltLess Than...
lteqLess Than or Equal To...
      And   Or
                
Sometimes you don’t know exactly what you are looking for in a Research data. That’s when our searching options may come handy.
The Domain Search
This search allows you to enter the domain name of the site you want to analyze. For example, you may enter “amazon.com” in the KeywordSpy search bar.

The Keyword Search
This will let you enter terms and key phrases in the search bar such as “send flowers”, “cover letters”, “keyword software,” and even a single broad term like “chocolate”.

The Ad Copy Search
This allows you to enter any texts or content included in an ad copy, whether the ones in ad copy headline or the ones in description lines. For example: “sunglasses”.
The Destination URL Search
This search allows you to enter the destination URL of the site that you want to analyze.

The destination URL is the address where a searcher is taken when an advertisement copy in search engines is clicked. Please take note that the destination URL differs from the display URL which appears at the bottom of advertisement copies.

Please be reminded to always include http:// at the beginning of your Destination URL search. For example: “http://www.proflowers.com”.

In addition, if you want to find all the ads that KeywordSpy indexed for a specific affiliate network e.g. Hydra Network. You should search in Destination URL the string lynxtrack.com.
Loading
  Loading...