Domain: biol.sc.edu

Overview
Ads (0)
PPC Keywords (0)
Organic Keywords (236)
Competitors (1,155)
Sub-Domains
biol.sc.edu
Paid Keywords
Keywords found: 0
#Competitors: 0
#Ad Copies: N/A
 
Organic Keywords
Keywords found: 236
#Competitors: 1,176
Average Position: N/A
 
PPC Overview
No Results Found
Organic Overview
Keywords (236) Position
we they 16
sc bio 1
mousseau 2
sc science 13
major in university 17
biological sciences 15
biology curriculum 2
major university 20
south david 10
stratmann 10
View More »
Competitors (1,176) Keywords
en.wikipedia.org 28,718,623
books.google.com 13,486,892
springerlink.com 3,444,879
linkinghub.elsevier.com 4,514,823
amazon.com 22,358,187
nature.com 972,788
links.jstor.org 3,474,837
cat.inist.fr 2,162,817
youtube.com 30,834,319
pubmedcentral.nih.gov 1,319,359
View More »
Organic Listing Variations
1.
babies
Adobe Web Photo Gallery / babies 9/24/02. Previous · Home · Next. babies.jpg.
2.
ADAPTORS Stock # Adaptor Sequence Length ...
RY-146 PCR CONTROL 2 FOR ATGCTTAATCAGTGAGGCACCTAT 24-mer plasmid contamin. ... RY-143 PCR PRIMER CTTGGAATTC 10-mer ECO RI SITE RY-71 Random 9-mers NNNNNNNNN ...
3.
Bacterial Infection Promotes Colon Tumorigenesis in Apcmin/+ Mice
File Format: Microsoft Powerpoint - View as HTML AE Lesions. Attaching and Effacing lesions during colon infection. Dissolution of brush border,; cupping of adherent bacteria,; cytoskeleton rearrangements ...
4.
Bacterial Infection Promotes Colon Tumorigenesis in Apcmin/+ Mice
File Format: Microsoft Powerpoint - View as HTML Bacterial Infection Promotes Colon Tumorigenesis in Apcmin/+ Mice. Joseph V. Newman, Takeo Kosaka, Barbara J. Sheppard, James G. Fox, and David B. Schauer ...
5.
Bacterial Infection Promotes Colon Tumorigenesis in Apcmin/+ Mice
File Format: Microsoft Powerpoint - View as HTML Bacterial Infection Promotes Colon Tumorigenesis in Apcmin/+ Mice. Joseph V. Newman, Takeo Kosaka, Barbara J. Sheppard, James G. Fox, and David B. Schauer ...
6.
Bacterial Infection Promotes Colon Tumorigenesis in Apcmin/+ Mice
File Format: Microsoft Powerpoint - View as HTML Bacterial Infection Promotes Colon Tumorigenesis in Apcmin/+ Mice. Joseph V. Newman, Takeo Kosaka, Barbara J. Sheppard, James G. Fox, and David B. Schauer ...
7.
Bacterial Infection Promotes Colon Tumorigenesis in Apcmin/+ Mice
File Format: Microsoft Powerpoint - View as HTML Bacterial Infection Promotes Colon Tumorigenesis in Apcmin/+ Mice. Joseph V. Newman, Takeo Kosaka, Barbara J. Sheppard, James G. Fox, and David B. Schauer ...
8.
Bacterial Infection Promotes Colon Tumorigenesis in Apcmin/+ Mice
File Format: Microsoft Powerpoint - View as HTML Bacterial Infection Promotes Colon Tumorigenesis in Apcmin/+ Mice. Joseph V. Newman, Takeo Kosaka, Barbara J. Sheppard, James G. Fox, and David B. Schauer ...
9.
UNDERGRADUATE INDEPENDENT STUDY CONTRACT
File Format: PDF/Adobe Acrobat - View as HTML UNDERGRADUATE INDEPENDENT STUDY CONTRACT. ALL required signatures must be obtained prior to registration. Student’s Name (Print). Phone. Student ID Number: ...
10.
Wells' harpacticoid keys
This is a web edition of Dr. JBJ Wells’ “Keys to Aid in the Identification of Marine Harpacticoid Copepods” (1976) including all updated information (Wells ...
 
View More »
ascSort Ascending
descSort Descending
eqEquals...
!eqDoes Not Equal...
gtGreater Than...
gteqGreater Than or Equal To...
ltLess Than...
lteqLess Than or Equal To...
      And   Or
                
Sometimes you don’t know exactly what you are looking for in a Research data. That’s when our searching options may come handy.
The Domain Search
This search allows you to enter the domain name of the site you want to analyze. For example, you may enter “amazon.com” in the KeywordSpy search bar.

The Keyword Search
This will let you enter terms and key phrases in the search bar such as “send flowers”, “cover letters”, “keyword software,” and even a single broad term like “chocolate”.

The Ad Copy Search
This allows you to enter any texts or content included in an ad copy, whether the ones in ad copy headline or the ones in description lines. For example: “sunglasses”.
The Destination URL Search
This search allows you to enter the destination URL of the site that you want to analyze.

The destination URL is the address where a searcher is taken when an advertisement copy in search engines is clicked. Please take note that the destination URL differs from the display URL which appears at the bottom of advertisement copies.

Please be reminded to always include http:// at the beginning of your Destination URL search. For example: “http://www.proflowers.com”.

In addition, if you want to find all the ads that KeywordSpy indexed for a specific affiliate network e.g. Hydra Network. You should search in Destination URL the string lynxtrack.com.
Loading
  Loading...